View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_44 (Length: 412)
Name: NF9913A_low_44
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 103 - 212
Target Start/End: Original strand, 42590894 - 42591004
Alignment:
| Q |
103 |
tggcaatcatattgggtagtgagcatagtggtgataacagaattgaagaagggcattc-cctatggaatagtgtggttaaagataatttctaactgtaat |
201 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
42590894 |
tggcagtcatgttgggtagtgagcatagtggtgataacagaattgaagaagggccttctcctatggaatagtgtggttgaagataatttctaaccgtaat |
42590993 |
T |
|
| Q |
202 |
acaagctggtg |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
42590994 |
acaagctggtg |
42591004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 249 - 358
Target Start/End: Original strand, 42591181 - 42591288
Alignment:
| Q |
249 |
atgtttcgtgtacatcgttttaacaccattctatagacattatgttgaaatgtcgtagcatgaattgaaacggtggcttactatttgcgttgcaatgaaa |
348 |
Q |
| |
|
||||||| |||| ||||||||||||||||| ||| ||| | ||||||||| | ||||||||||| |||| | |||||||||||| |||| ||||||| |
|
|
| T |
42591181 |
atgtttcttgtatatcgttttaacaccattacatacacagt--gttgaaatgacctagcatgaattcaaacaatagcttactatttgtgttgaaatgaaa |
42591278 |
T |
|
| Q |
349 |
ctttttctat |
358 |
Q |
| |
|
|||||||||| |
|
|
| T |
42591279 |
ctttttctat |
42591288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University