View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_447 (Length: 218)
Name: NF9913A_low_447
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_447 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 10543237 - 10543044
Alignment:
| Q |
13 |
atcaaccaaagaatgagtttgcatccatattattctaatctgcttgccgcaaattgcagccaaggtggtatttgctaaatcttcaatatttcattacaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10543237 |
atcaaccaaagaatgagtttgcatccatattattctaatctgcttgcctcaaattgcagccaaggtggtatttgctaaatcttcaatatttcattacaat |
10543138 |
T |
|
| Q |
113 |
gcatctgttaaccaaaagacatgctgaaggatcaatcagcggtgccaaagtagcgatcaccaaattcacccaacccagggataacaccaaactc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10543137 |
gcatctgttaaccaaaagacatgctgaaggatcaatcatcggtgccaaagtagcgatcaccaaattcacccaacccagggataacacgaaactc |
10543044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University