View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_454 (Length: 214)
Name: NF9913A_low_454
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_454 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 140
Target Start/End: Original strand, 15128439 - 15128565
Alignment:
| Q |
17 |
tcatcagtaattacaccacgcctagccaaattatcattggtaggtaacctattacgtaaaatacgtcatgcaaaaactgaaaccttcaacatgac---at |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |
|
|
| T |
15128439 |
tcatgagtaattacaccacgcctagccaaattatcattggtaggtaacctattacgtaaaagacgtcatgcaaaaactgaaaccttcaacatgacatgat |
15128538 |
T |
 |
| Q |
114 |
atttatgtcaaaacctaatatattaac |
140 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
15128539 |
atttatgtcaaaacctaatatattaac |
15128565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University