View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_458 (Length: 211)
Name: NF9913A_low_458
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_458 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 42693381 - 42693543
Alignment:
| Q |
1 |
acggtcatccaaggaattttcttccactcatccgtcgtctacagatcttggttaaaacaatattgtttaaggaattcataaaaaacaacttttatgttgg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| ||||||||||||| |||||| |
|
|
| T |
42693381 |
acggtcatccaagaaattttcttccactcatccgtcgtctacagatcttggttgaaacaatattgtttaagggattcat-aaaaacaacttttgtgttgg |
42693479 |
T |
|
| Q |
101 |
tgatnnnnnnnttaaagcat-gtgtaaaacaataaattcatcattttcttatacaaactttctcttttaa |
169 |
Q |
| |
|
|||| ||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42693480 |
tgataaa------aaaaaataacgtaaaacaataaattcatcattttcttatacaaactttctcttttaa |
42693543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University