View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_460 (Length: 211)
Name: NF9913A_low_460
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_460 |
 | |
|
| [»] scaffold0110 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0110 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 13086 - 13269
Alignment:
| Q |
16 |
tttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttggttatgatactggcttttttgcccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13086 |
tttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttggttatgatactggcttttttgcccc |
13185 |
T |
|
| Q |
116 |
tggaaggtgttcaaaaggatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaatttgatatt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13186 |
tggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaatttgatatt |
13269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 20823 - 21006
Alignment:
| Q |
16 |
tttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttggttatgatactggcttttttgcccc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20823 |
tttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttggttatgatactggcttttttgcccc |
20922 |
T |
|
| Q |
116 |
tggaaggtgttcaaaaggatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaatttgatatt |
199 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20923 |
tggaaggtgttcaaaagaatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaatttgatatt |
21006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 29943 - 30126
Alignment:
| Q |
16 |
tttgtttcaaaacatttggagacagagttaagaactggatgactttcaatgaaccaagagttattgctgcacttggttatgatactggcttttttgcccc |
115 |
Q |
| |
|
||||||| || ||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29943 |
tttgttttaagacatttggagacagagttaagaattggatgaccttcaatgaaccaagagttgttgctgcacttggttatgataatggcttttttgcccc |
30042 |
T |
|
| Q |
116 |
tggaaggtgttcaaaaggatatggaaattgtactgctggaaattcaggaactgagccttatattgtagctcacaatttgatatt |
199 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30043 |
tggaagatgttcaaaagaatatggaaattgtacagctggaaattcaggaactgagccttatactgtagctcacaatttgatatt |
30126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 31639059 - 31639108
Alignment:
| Q |
21 |
ttcaaaacatttggagacagagttaagaactggatgactttcaatgaacc |
70 |
Q |
| |
|
|||||| | |||||||||||||||||| ||||||| || ||||||||||| |
|
|
| T |
31639059 |
ttcaaagcttttggagacagagttaagcactggattaccttcaatgaacc |
31639108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University