View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_463 (Length: 211)
Name: NF9913A_low_463
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_463 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 8317322 - 8317112
Alignment:
| Q |
1 |
ttagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggctatgtaggtcatgggatgccgcataata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8317322 |
ttagttgtgctgtaccatacccagagtaagtgaattgcttgagatgcaaagcattgaatttgatggattggctatgtaggtcatgggatgccgcattata |
8317223 |
T |
|
| Q |
101 |
aaattcaatgtcttgttctatggaaacaatttcaagtagaggagcttctaaaataagatcttttccacccgaccaattgcagtttttgatatcaaacttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8317222 |
aaattcaatgtcttgttctatggaaacaatttcaagtagaggagcttctacaataagatcttttccacccgaccaattgcagtttttgatatcaaacttt |
8317123 |
T |
|
| Q |
201 |
ctaagaagtgg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
8317122 |
ctaagaagtgg |
8317112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 110 - 195
Target Start/End: Original strand, 8358987 - 8359072
Alignment:
| Q |
110 |
gtcttgttctatggaaacaatttcaagtagaggagcttctaaaataagatcttttccacccgaccaattgcagtttttgatatcaa |
195 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||| || ||||||||||||| ||| ||||| |||||||||| ||||||| |
|
|
| T |
8358987 |
gtcttgttctatggaaatgttttcaagaagaggagcttgtacgataagatcttttctaccacaccaaatgcagtttttaatatcaa |
8359072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 198
Target Start/End: Complemental strand, 7795631 - 7795571
Alignment:
| Q |
138 |
agaggagcttctaaaataagatcttttccacccgaccaattgcagtttttgatatcaaact |
198 |
Q |
| |
|
|||| |||||||| ||||| ||| ||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
7795631 |
agagaagcttctacaataacatcctttccacttgaccaattgcagttcttgatctcaaact |
7795571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University