View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_465 (Length: 210)
Name: NF9913A_low_465
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_465 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 12 - 185
Target Start/End: Complemental strand, 11311908 - 11311735
Alignment:
| Q |
12 |
tggacatcaaaatttcaagatattatctttgttgaaagacaaaatcaatgtaacacaatgggtatcaaaacttgttgtttgtgttagttgtcaaatggga |
111 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11311908 |
tggacatccaaatttcaagatattatctttgttgaaagacaaaatcaatgtaacacaatgggtatcaaaacctgttgtttgtgttagttgtcaaatggga |
11311809 |
T |
|
| Q |
112 |
aaaaattgtaaattgccattccaaagttctaataaaatttcagaatttcctcttgataaaatccattgtgatct |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11311808 |
aaaagttgtaaattgccattccaaagttctaataaaatttcagaatctcctcttgataaaatccattgtgatct |
11311735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University