View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_471 (Length: 209)
Name: NF9913A_low_471
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_471 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 209
Target Start/End: Original strand, 10982768 - 10982957
Alignment:
| Q |
19 |
agaagaaggtggaagttcccttgtcgctttgaataagttggctaagttgtggaagcagaattagaagtaacataatataacttttttatatgatattggt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
10982768 |
agaagaaggtggaagttcccttgtcgctttgaataagttggctcagttgtggaagcagaattagaagtaacataatataactttt-tatatgatatgggt |
10982866 |
T |
|
| Q |
119 |
tttgttggcccttatcataagttgttttgttgtctcataaaataaaatttatgaataaaacggtgttgaaattgtgattcggataaattgg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
10982867 |
tttgttggcccttatcataagttgttttgttgtctcataaaataaaatttatgaataaaatggtggtgaaattgtgattcggataaattgg |
10982957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 10968818 - 10968877
Alignment:
| Q |
19 |
agaagaaggtggaagttcccttgtcgctttgaataagttggctaagttgtggaagcagaa |
78 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
10968818 |
agaagaaggtggaagttcacttgttgctttgaataatctggcacagttgtggaagcagaa |
10968877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University