View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_474 (Length: 208)
Name: NF9913A_low_474
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_474 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 54383873 - 54383672
Alignment:
| Q |
1 |
gaacccaatatgcttgctcctgtagatgtgtttgttagtactgtggatcccttgaaggaacctcctctgaatacagccaacacagttctttcaatcttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54383873 |
gaacccaatatgcttgctcctgtagatgtgtttgttagtactgtggatcccttgaaggaacctcctctgaatacagccaacacagttctttcaatcttgg |
54383774 |
T |
 |
| Q |
101 |
caatggactaccccattgataagatatcatgctacatttctgatgatggagcttcaatgtgtgcatttgaagccctgtcggaaacggcagagtttgctag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54383773 |
caatggactaccccattgataagatatcatgctacatttctgatgacggagcttcaatgtgtacatttgaagccctgtcggaaacggcagagtttgctag |
54383674 |
T |
 |
| Q |
201 |
ga |
202 |
Q |
| |
|
|| |
|
|
| T |
54383673 |
ga |
54383672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University