View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9913A_low_478 (Length: 207)

Name: NF9913A_low_478
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9913A_low_478
NF9913A_low_478
[»] chr7 (1 HSPs)
chr7 (22-186)||(47137120-47137284)


Alignment Details
Target: chr7 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 22 - 186
Target Start/End: Complemental strand, 47137284 - 47137120
Alignment:
22 gtatggtggtgactaaatttcatgtggattgctttgatcagggtctatgcaccggtgtggttattttgtggataagtggtggtaaaagctcgcatctact 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47137284 gtatggtggtgactaaatttcatgtggattgctttgatcagggtctatgcaccggtgtggttattttgtggataagtggtggtaaaagctcgcatctact 47137185  T
122 agtttttagtgaagatcnnnnnnnnatatatcttctacctcccatcatctttaatgccgggtaat 186  Q
    |||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||    
47137184 agtttttagtgaagatcttttttttatatatcttctacctcccatcatctttaatgccgggtaat 47137120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University