View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_483 (Length: 205)
Name: NF9913A_low_483
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_483 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 176
Target Start/End: Complemental strand, 42354327 - 42354171
Alignment:
| Q |
20 |
tcatctttggtgaaggcggtttgaactaagtaacaacatgatttatatttggaccgaatgttttgctctttgcatacaacgacactccttgaagagagtc |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42354327 |
tcatctttggggaaggcggtttgaactaagtaacatcatgatttatatttggaccgaatgttttgctctttgcatacaacgacactccttgaagagagtc |
42354228 |
T |
 |
| Q |
120 |
atttgctcaatgtacaatgatatgaggagccctttgctctctgcatgcaacaccaaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42354227 |
atttgctcaatgtacaatgatatgaggagccctttgctctctgcatgcaacaccaaa |
42354171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University