View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_486 (Length: 204)
Name: NF9913A_low_486
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_486 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 8439356 - 8439187
Alignment:
| Q |
17 |
acatcatgtctcaactcaaaactttaagacattggatcacaactcttatatccttcatttaactaatgtcacattaattgttgtcatttgaaatggtttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8439356 |
acatcatgtctcaactcaaaactttaagacattggatcacaactcttatatccttcatttaactaatgtcacattaattgttgtcatttgaaatggtttg |
8439257 |
T |
|
| Q |
117 |
tttaggtactagaaaaaagaatactgctacaaagaaatgaaagtgatggaaaagtaattgatttgaacac |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8439256 |
tttaggtactagaaaaaagaatactgctacaaagaaatgaaagtgatggaaaagtaattaatttgaacac |
8439187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University