View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_490 (Length: 203)
Name: NF9913A_low_490
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_490 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 25 - 166
Target Start/End: Original strand, 20489450 - 20489592
Alignment:
| Q |
25 |
agatcccaccataattttgagagcttcaaagtcactcttt-aacaaattaaaagtaattgcttggagggtaatttcttttgactaggattgatttactat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489450 |
agatcccaccataattttgagagcttcaaagtcactcttttaacaaattaaaagtaattgcttggagggtaatttcttttgactaggattgatttactat |
20489549 |
T |
 |
| Q |
124 |
ggcccattaatatctcactgcttcctctttaggttcatctcat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20489550 |
ggcccattaatatctcactgcttcctctttaggttcatttcat |
20489592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University