View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_495 (Length: 202)
Name: NF9913A_low_495
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_495 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 37372187 - 37372304
Alignment:
| Q |
1 |
tcactcaagaccgcaccaaaataatgttatgtacatacaaaacctacaaattttgcattaaggaaataaatgagatggatggtagtcaaattaacagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
37372187 |
tcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtcaaattactagtgg |
37372286 |
T |
|
| Q |
101 |
caagtggagatttaggaa |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37372287 |
caagtggagatttaggaa |
37372304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 136 - 199
Target Start/End: Original strand, 37372290 - 37372354
Alignment:
| Q |
136 |
gtggagatttaggaaaactaaaagagaaaatattataaaa-ttttagagattgatgcgttcgaga |
199 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
37372290 |
gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgaga |
37372354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University