View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_83 (Length: 347)
Name: NF9913A_low_83
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_83 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 327
Target Start/End: Original strand, 38550 - 38863
Alignment:
| Q |
9 |
aatgattggacatgtcttatgaactctggttttatttaaacctaaatttccgacatttactccacttataaatttgtttatgtggctaatttccattgga |
108 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38550 |
aatgattgaacatgtcttatgaaatctggttttatttaatcctaaatttccgacatttactccacttataaatttgtttatgtggctaatttccattgga |
38649 |
T |
|
| Q |
109 |
tgatgtattgatgggtaaattactcac--nnnnnnnnnccaaagataatctagaaaggaaaaaaccaaaatattaatgagtgggtgaagcagattgccgg |
206 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38650 |
tgatgtattcatgggtaaattactcactttttattttttcaaagataatctagaaaagaaaaaaccaaaatattaatgagtgggtgaagcagattgccgg |
38749 |
T |
|
| Q |
207 |
attggctctgagttggaagacactagacacctttattgttgttgcttctatgtataaaacatttcaaatttttaaaccacaaacagcttccttggctgtg |
306 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38750 |
attggctctgagttgga-------agacacctttattgttgttgcttctatgtataaaacatttcaaatttttaaaccacaaacaacttccttggctgtg |
38842 |
T |
|
| Q |
307 |
agggagcttcttgttattttc |
327 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38843 |
agggagcttcttgttattttc |
38863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University