View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_88 (Length: 345)
Name: NF9913A_low_88
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_88 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 157 - 341
Target Start/End: Complemental strand, 29486634 - 29486455
Alignment:
| Q |
157 |
gacctcactttcatttttatattgaacaatatgtctttttcttttgaaccttacactttttaggtgcaaaaatttaatatgaaaatgaaaat-tcctcta |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29486634 |
gacctcactttcatttttatattgaacaatatgtctttt------gaaccttacactttttaggtgcaaaaatttaatatgaaaatgaaaatctcctcta |
29486541 |
T |
 |
| Q |
256 |
tcatgtgcatagtgtgtgtccacaaatgtttgggaggacaaagttttatttattttcttccttctcatttatggaacttggacgtg |
341 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29486540 |
tcatgtgcatagtgtgtgtccacaaatggttgggaggacaaagttttatttattttcttccttctcatttatggaacttggacgtg |
29486455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 29486829 - 29486663
Alignment:
| Q |
1 |
atgaaaacgaaaggtaaatccatggggaccacgaatggggtaaagaggctaactatacatttgaaagacttaggtagagtcaatgtcttggccctatagt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29486829 |
atgaaaacgaaaggtaaatctatggggaccacgaatggtgtaaagaggctaactatacatttgaaagacttaggtagagtcaatgtcttgcccctatagt |
29486730 |
T |
 |
| Q |
101 |
tacttaaaaataattgcatgccaaataattaatatccatttttaaaaaagactagagacctcactttc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29486729 |
tacttaaaaataattgcatgccaaataattaatatccattttta-aaaagactagagacctcactttc |
29486663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University