View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9913A_low_94 (Length: 339)
Name: NF9913A_low_94
Description: NF9913A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9913A_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 103 - 205
Target Start/End: Complemental strand, 48669494 - 48669392
Alignment:
| Q |
103 |
atgaagtaaagagtgaaagtgaaaacaaagacagcaagagaagagagaacagatgcaagatcataagttgcatcttcccaaatcttcttccaaagatctt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669494 |
atgaagtaaagagtgaaagtgaaaacaaagacagcaagagaagagagaacagatgcaagatcataagttgcatcttcccaaatcttcttccaaagatctt |
48669395 |
T |
 |
| Q |
203 |
ctt |
205 |
Q |
| |
|
||| |
|
|
| T |
48669394 |
ctt |
48669392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University