View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9915_high_8 (Length: 238)
Name: NF9915_high_8
Description: NF9915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9915_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 9645867 - 9645652
Alignment:
| Q |
16 |
gttccttcacactatatagcaatttggacaaccctgcaatacatatatgtatttgtattttcaagtttaatacatgaaatttcatatgtgtaaaaagaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9645867 |
gttccttcacactatatagcaatttggacaaccctgcaatacatat--gtatttgtattttcaagtttaatacatgaaatttcat--gtgtaaaaagaaa |
9645772 |
T |
 |
| Q |
116 |
cttgaagcaagtaggagtttgtatttgtaggtgcaagcgcgggaattttaggcttctatgttctgcatgcgataaaaagatgatgagctaaactaccact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9645771 |
cttgaagcaagtaggagtttgtatttgtaggtgcaagcgcgggaattttaggcttctatgttctgcatgcgataaaaagatgatgagctaaactaccact |
9645672 |
T |
 |
| Q |
216 |
aacaaaatcatctatttgga |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
9645671 |
aacaaaatcatctatttgga |
9645652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 210
Target Start/End: Complemental strand, 30364542 - 30364454
Alignment:
| Q |
123 |
caagtaggagtttgtatttgtaggtgcaagcgcgggaatttt-aggcttctatgttctgcatgcgataaaaagatgatgagctaaacta |
210 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | |||| | | ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
30364542 |
caagtaagagtttgtatttgtaggtgcaagggatggaactctcaggcttctatgttctgcattcgataaaaagatgatgagctaaacta |
30364454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University