View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9916_high_6 (Length: 436)
Name: NF9916_high_6
Description: NF9916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9916_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 276 - 419
Target Start/End: Complemental strand, 56166482 - 56166339
Alignment:
| Q |
276 |
aaaatgtcatgtgcctgttttactgaaatgcatcataattaatgattcttgaggatatgaaaactctatctagtctagtatagatgtcaaagcatagaac |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56166482 |
aaaatgtcatgtgcctgttttactgaaatgcatcataattaatgattcttgaggatataaaaactctatctagtctagtatagatgtcaaagcatagaac |
56166383 |
T |
|
| Q |
376 |
ttccttccttatagatacgtatatttattacttgattccaaaaa |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56166382 |
ttccttccttatagatacgtatatttattacttgattccaaaaa |
56166339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 93; Significance: 4e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 208 - 419
Target Start/End: Complemental strand, 44264610 - 44264408
Alignment:
| Q |
208 |
ctagttgcaatgaacatttctctacatggtttttctcttgttcgcatatattatataccgatgcaggcaaaatgtcatgtgcctgttttactgaaatgca |
307 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| | ||||||| || |||||| ||||||| | |||||||| ||||||||||||| | |
|
|
| T |
44264610 |
ctagttgcaatcaacatttctctacatggtttttctcttgtccacatatat-----actgatgcatgcaaaatatgatgtgcctcttttactgaaatgga |
44264516 |
T |
|
| Q |
308 |
tcataattaatgatt-cttgaggatatgaaaactctatctagtctagtatagatgtcaaagcatagaacttccttccttatagatacgtatatttattac |
406 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||| || | ||||||||||||||| | ||||||||||||||||||||| |||||||||||| |
|
|
| T |
44264515 |
ccataattaatgattacttgagtatatgaaaactcta-----tccaatatagatgtcaaagcttggaacttccttccttatagatatttatatttattac |
44264421 |
T |
|
| Q |
407 |
ttgattccaaaaa |
419 |
Q |
| |
|
||| ||||||||| |
|
|
| T |
44264420 |
ttgtttccaaaaa |
44264408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University