View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9916_high_7 (Length: 362)
Name: NF9916_high_7
Description: NF9916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9916_high_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 11 - 295
Target Start/End: Complemental strand, 28340821 - 28340539
Alignment:
| Q |
11 |
agcagagagtggtggttgagacattgatcaatttatttgcatttgaaacaaaggtgaatttcggaaaagcagatcgcaggttgtaactcgaaggatatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28340821 |
agcagagagtggtggttgagacattgatcaatttatttgcattcgaaacaaaggtgaatttcggaaaagcaaatcgcaggttgtaactcgaaggatatga |
28340722 |
T |
|
| Q |
111 |
agcttcgaaaattgaagaaagtcgggggnnnnnnnnnnnnnnnnnnnnttcttaacctaattgttaagaaggaaggggaagcagttaagagtgaggtgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28340721 |
agcttcgaaaattgaagaaagtcggggggagagagagagagagaga--ttcttaacctaattgttaagaaggaaggggaagcagttaagagtgaggtgaa |
28340624 |
T |
|
| Q |
211 |
aagtgagcagatcagtgagcactcgcaactccgagtgggttgttgtttgtgtttggttggagttcgggcttattggctcaccatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28340623 |
aagtgagcagatcagtgagcactcgcaactccgagtgggttgttgtttgtgtttggttggagttcgggcttattggctgaccatt |
28340539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University