View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_high_15 (Length: 267)
Name: NF9917A_high_15
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 5 - 255
Target Start/End: Original strand, 527884 - 528134
Alignment:
| Q |
5 |
caattagtaccacatgcaaagtatgtggaagttcctctaacgctggggaaatgtcacatgaggagcagcagctaagactggagaatgctctccttaggaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527884 |
caattagtaccacatgcaaagtatgtggaagttcctctaacgctggggaaatgtcacatgaggagcagcagctaagactggagaatgctctccttaggaa |
527983 |
T |
 |
| Q |
105 |
agaggtacctcatcatttattacgattttcaaaatagatatgccctgcaaaaaatttaaaataatgatccaacatttatgattaacttttatcgtgtaag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
527984 |
agaggtacctcatcatttattacgattttcaaaatagatatgccctgcaaaaaattaaaaataatgatccaacatttatgattaacttttaccgtgtaag |
528083 |
T |
 |
| Q |
205 |
tacattaaattaaatcatccttaattattcgctaacaacatctttcatatt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528084 |
tacattaaattaaatcatccttaattattcgctaacaacatctttcatatt |
528134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University