View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_high_18 (Length: 252)
Name: NF9917A_high_18
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 30411230 - 30411012
Alignment:
| Q |
24 |
aagagcatctgcttctttggaaaaagatgtttctgcaggtaacttaccaatcaagtttctagctgtatttacctcctgacctgttacttgacagcattga |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
30411230 |
aagagcatctgcttctttggacaaagatgtttctgcaggtaacttaccaatcaagtttctagatgtatttgcctcctgacctgta--ttgacagcattga |
30411133 |
T |
 |
| Q |
124 |
gatcttgttcaaagtcaccatcattggctccatctcaacaaggttggaccatgactcttttaagaactagatatcttgttgcaggactgcttgttcatca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30411132 |
gatcttgttcaaagtcaccatcattggcttcatctcaacaaggttggaccatgactcttttaagaactagatatcttgttgcaggactgcttgatcatca |
30411033 |
T |
 |
| Q |
224 |
tcattagcactgttctctgat |
244 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
30411032 |
tcattagcactgttttctgat |
30411012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University