View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_100 (Length: 301)
Name: NF9917A_low_100
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_100 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 8 - 280
Target Start/End: Original strand, 8631150 - 8631422
Alignment:
| Q |
8 |
tgaaatgaattggaatttgaagggcgatacatacctaaaggaagtagaacctcgtcgagaagaaatccaccaccgttagcgagaggatcggcggcggttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8631150 |
tgaaatgaattggaatttgaagggcgatacatacctaaaggaagtagaacctcgtcgagaagaaatccaccaccgttagcgagaggatcggcggcggttt |
8631249 |
T |
 |
| Q |
108 |
gcggaggggtgggtttatagtgttgctgccaagcgagagaggagcagagaagagaaagggatttaccggaaccggtgggggactccagtaacgcgtgaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8631250 |
gcggaggggtgggtttatagtgttgctgccaagcgagagaggagcagagaagagaaagggatttaccggaaccggtgggggactccagtaacgcgtgaga |
8631349 |
T |
 |
| Q |
208 |
gtgaccttctttctgagctcgattaagggttgagataactcgacccataaacgcgaattgagaaccgtagggt |
280 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8631350 |
gtgaccttcattctgagctcgattaagggttgagataactcgacccataaacgcgaattgagaaccgtagggt |
8631422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University