View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_104 (Length: 300)
Name: NF9917A_low_104
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_104 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 166 - 297
Target Start/End: Original strand, 1860915 - 1861046
Alignment:
| Q |
166 |
agttttgagaatgtctcgcacttgcatgatgatgctcttggtagcaatgttcattttcaccgtcgtcgcagaatctccagcgacatctcccaaagtttct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1860915 |
agttttgagaatgtctcgcacttgcatgatgatgctcttggtagcaatgttcattttcaccgccgtcgcagaatctccaacgacatctcccaaagtttct |
1861014 |
T |
|
| Q |
266 |
tctttgactaccccagttgctgctccatctcc |
297 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
1861015 |
tctttgactaccccagctgctgctccatctcc |
1861046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 1860752 - 1860843
Alignment:
| Q |
1 |
aatatctctttgctcaaaccctaattccacttgtatggtttcgatttaatacgcgctttctccttctataaattctctatcaatgaccctta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1860752 |
aatatctctttgctcaaaccctaattccacttgtatggtttcgatttaatacgcgctttctccttctataaattctctatcaatgaccctta |
1860843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 1860605 - 1860673
Alignment:
| Q |
1 |
aatatctctttgctcaaaccctaattccacttgtatggtttcgatttaatacgcgctttctccttctat |
69 |
Q |
| |
|
|||||| |||||||||||| |||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1860605 |
aatatcgctttgctcaaactctaatttcacgtgtatggtctcgatttaatacgcgctttctccttctat |
1860673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University