View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_114 (Length: 292)
Name: NF9917A_low_114
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_114 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 58 - 270
Target Start/End: Original strand, 8138142 - 8138367
Alignment:
| Q |
58 |
gttggtttttgagatttcaaccaccatcgagaatgaagcttaaatcc------------gatcaagaaacaatcgtttgttgnnnnnnnn-tacgagagt |
144 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
8138142 |
gttggtttttgacatttcaaccaccaccgagaatgaagcttaaatcctatcaaacaaatgatcaagaaacaatcgtttgttgaaaaaaaaatacgagagt |
8138241 |
T |
|
| Q |
145 |
tttgcgccttccaaatgaccatgatagaggaccttgatgttatgttatcctgctggagaaaaagtaagcatggatcacttaccatttgtttttgttgttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||| |||||||||| | |
|
|
| T |
8138242 |
tttgcgccttccaaatgaccatgatagaggaccttgatgttatgttttcctgctggagaaaaagtaagcatgaatcatttaccatttatttttgttgtgc |
8138341 |
T |
|
| Q |
245 |
taatttttcaggtagaaggagcttca |
270 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
8138342 |
tatcttttcaggtagaaggagcttca |
8138367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University