View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_118 (Length: 289)
Name: NF9917A_low_118
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_118 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 23 - 274
Target Start/End: Complemental strand, 29742297 - 29742046
Alignment:
| Q |
23 |
agtagtgattgacctcttcgtatttacaaattatgttccctaaaagaaagtttacaaaattatgtctttgttcagttgctttggtcaaagaaaggaaaat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742297 |
agtagtgattgacctcttcgtatttacaaattatgttccctaaaagaaagtttacaaaattatgtctttgttcagttgctttggtcaaagaaaggaaaat |
29742198 |
T |
 |
| Q |
123 |
aagattataattttcctgttgtaaatttataatgaatgttgtcgatcttcccctnnnnnnntaaatcaatgttgtcgatctaaatgacggtaaaaaagaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742197 |
aagattataattttcctgttgtaaatttataatgaatgttgtcgatcttcccctaaaaaaataaatcaatgttgtcgatctaaatgacggtaaaaaagaa |
29742098 |
T |
 |
| Q |
223 |
agttttgctcaaggtatcttattaaaaagaaattaacaataaactgttgtat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29742097 |
agttttgctcaaggtatcttattaaaaagaaattaacaataaactgttgtat |
29742046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University