View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_140 (Length: 273)
Name: NF9917A_low_140
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_140 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 25 - 263
Target Start/End: Original strand, 31506658 - 31506896
Alignment:
| Q |
25 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31506658 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
31506757 |
T |
 |
| Q |
125 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31506758 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
31506857 |
T |
 |
| Q |
225 |
cttggctgagtctgccttcgttcataaataagatctctg |
263 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
31506858 |
cttggctgagtctgctttcattcataaataagatctctg |
31506896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 25 - 263
Target Start/End: Complemental strand, 34496101 - 34495863
Alignment:
| Q |
25 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34496101 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgatacaatgtactcgtataaagacctaaacaaacgacaagagtggattg |
34496002 |
T |
 |
| Q |
125 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496001 |
cttaccttcaagctggtgctggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
34495902 |
T |
 |
| Q |
225 |
cttggctgagtctgccttcgttcataaataagatctctg |
263 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34495901 |
cttggctgagtctgctttcgttcataaataagatctctg |
34495863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 25 - 263
Target Start/End: Complemental strand, 27607648 - 27607410
Alignment:
| Q |
25 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
124 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27607648 |
gacatagctctagctctaaggacaatagtatttccaactgggactaggtacgatacaatgtactcgtataaagacctaaacaaacgacaagagtggattg |
27607549 |
T |
 |
| Q |
125 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
224 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27607548 |
cttaccttcaagctggtgcaggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
27607449 |
T |
 |
| Q |
225 |
cttggctgagtctgccttcgttcataaataagatctctg |
263 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27607448 |
cttggctgagtctgctttcgttcataaataagatctctg |
27607410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University