View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_158 (Length: 261)
Name: NF9917A_low_158
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_158 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 4 - 261
Target Start/End: Complemental strand, 43164328 - 43164071
Alignment:
| Q |
4 |
agtacaacacacacttaaaagctgatctggactcacacgggcagaatgatctctactcttcgatcgctgaatgtcatttgtgtgttgaatgacctcgaat |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164328 |
agtacaacacacactcaaaagctgatctggactcacacgggcagaatgatctctgctcttcgatcgctgaatgtcatttgtgtgttgaatgacctcgaat |
43164229 |
T |
 |
| Q |
104 |
tcgacatgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagcttgttgtctaattttcaaacc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43164228 |
tcgacatgaagatttctatccttcacaagagtgacctcaaaaacagttaatggcaacctttcagtcactcacaaatagccagttgtctaattttcaaacc |
43164129 |
T |
 |
| Q |
204 |
ctttacattttgtttttaggtttctaatgcattgactaaattatcatcaacgactatt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43164128 |
ctttacattttgtttttaggtttctaatgcattgactaaattatcatcaacgactatt |
43164071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University