View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_166 (Length: 258)
Name: NF9917A_low_166
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_166 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 3 - 258
Target Start/End: Complemental strand, 1329702 - 1329447
Alignment:
| Q |
3 |
ctcttcttcttttggctcttccaccacttcttcggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1329702 |
ctcttcttcttttggctcttccaccacttcttcggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggt |
1329603 |
T |
 |
| Q |
103 |
tcgggttccttggcttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329602 |
tcgggttccttggcttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataa |
1329503 |
T |
 |
| Q |
203 |
cctctaacttctttggtgtgaccttatctatctcagggtactcagaagagcgacaa |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329502 |
cctctaacttctttggtgtgaccttatctatctcagggtactcagaagagcgacaa |
1329447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University