View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_175 (Length: 253)
Name: NF9917A_low_175
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_175 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 11 - 253
Target Start/End: Complemental strand, 528474 - 528232
Alignment:
| Q |
11 |
caaagagggggtccatatgtcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528474 |
caaagagggggtccatatgtcctagccaatttggtcagttcatccattccaacaacagcaagctctacaatcttttgcttctcattaagacccttaatct |
528375 |
T |
 |
| Q |
111 |
gcactgaggagccaccaacgcttaaaccctcttctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatcagtagagcgtgaagcaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
528374 |
gcactgaggagccaccaacgcttaaaccctctcctaccatgcggtggcttgctccattgttaccaccggcaactccaaaatccgtagagtgtgaagcaac |
528275 |
T |
 |
| Q |
211 |
atgagtgctattgttggatgatgttatattggcacgagagtct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
528274 |
atgagtgctattgttggatgatgttatattggcacgagagtct |
528232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University