View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_200 (Length: 248)
Name: NF9917A_low_200
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_200 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 28 - 246
Target Start/End: Original strand, 38885922 - 38886141
Alignment:
| Q |
28 |
gaaaagtaatagtctaacaatttaatcatcaatctttgtctatccaaaacaaaaacttgtcaatgttgttgttattattttctgtccgattctacttgta |
127 |
Q |
| |
|
||||||||||| |||||| |||||| |||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38885922 |
gaaaagtaataatctaacgatttaaccatcaacctttgtctatccaaaacaaaaacttggcaatgttgttgttattattttctgtcggattctacttgta |
38886021 |
T |
|
| Q |
128 |
aaagcggtatttgtttccttt-catgcccattaattcagataagctgctttgatttgtgttgagtaacctctccccttctgtctcgacgcctgtttatca |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38886022 |
aaagcggtatttgtttcctttgcatgcccgttaattcagataagctgctttgatctgtgttgagtaatctctccccttctgtctcgacgcctgtttatca |
38886121 |
T |
|
| Q |
227 |
ccgaaggagaaatgcatgtt |
246 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38886122 |
ccgaaggagaaatgcatgtt |
38886141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University