View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_204 (Length: 247)
Name: NF9917A_low_204
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_204 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 7617740 - 7617568
Alignment:
| Q |
1 |
ggtaattgttatgtgtagctgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617740 |
ggtaattgttatgtgtagttgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttct |
7617641 |
T |
 |
| Q |
101 |
gtctttaaagtgnnnnnnnnnccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
175 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617640 |
gtctttaaagtg--aaaaaaaccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgc |
7617568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University