View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_221 (Length: 245)
Name: NF9917A_low_221
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_221 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 16 - 233
Target Start/End: Original strand, 9538999 - 9539217
Alignment:
| Q |
16 |
ggacatcccatgcatcagcttatagttgcagattcttctcacacaaatttttcagtgatatatcaatgttgttggaacattgttcaattatttaaattat |
115 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
9538999 |
ggacatcacatgcatcagtttatagttgcagattcttctcacacaaatttttcaatgatatatcaattttgttggaacattgttgaattatttaaattat |
9539098 |
T |
|
| Q |
116 |
gaactaagttcaaatatgattttttaaatatacta-nnnnnnnnaactcatgcataagattagaaactcacatttagatttccttgtgttannnnnnnca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9539099 |
gaactaagttcaaatatgattttttaaatatactatttttttttaactcatgcataagattagaaactcacatttagatttccttgtgttatttttttca |
9539198 |
T |
|
| Q |
215 |
tttcaagtgtcatattctt |
233 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
9539199 |
tttcaagtgtcattttctt |
9539217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University