View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_228 (Length: 244)
Name: NF9917A_low_228
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_228 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 22 - 225
Target Start/End: Complemental strand, 29222829 - 29222619
Alignment:
| Q |
22 |
ggtagtttgttctagctatctctatctttttagaagagaaattatatttgta-caaccatttctttgtatttggttgtcctttaaattattttaaaaacc |
120 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||||||||| |||| |||| || |||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
29222829 |
ggtagtttgttttagctatctttgtctttttagaagagaaatgatatatgtatcatttatttgtatgtatttagttgtcctttaaattattttaaaaatg |
29222730 |
T |
 |
| Q |
121 |
attgatcaaattacatatctcct-------tggcttggtgttttaatggagttttggagttgagagcttacttggctagtcgtttttagctcatagtttt |
213 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| |||| | ||||||||||||| |||||||||||||||| | |||||||||| | ||||| |
|
|
| T |
29222729 |
attgatcaaataacatatctccttctaaaatggcttggtg-tttattaaagttttggagttgggagcttacttggctagccatttttagctcgttgtttt |
29222631 |
T |
 |
| Q |
214 |
ttgtttgagaat |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
29222630 |
ttgtttgagaat |
29222619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 22 - 94
Target Start/End: Complemental strand, 29226774 - 29226702
Alignment:
| Q |
22 |
ggtagtttgttctagctatctctatctttttagaagagaaattatatttgtacaaccatttctttgtatttgg |
94 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29226774 |
ggtagtttgttctagctatctctgtctttttagaagagaaatcatatttgtacaaccatttctttgtatttgg |
29226702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 82
Target Start/End: Complemental strand, 305052 - 305018
Alignment:
| Q |
48 |
tttttagaagagaaattatatttgtacaaccattt |
82 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
305052 |
ttttgagaagagaaattatatttgtacaaccattt |
305018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University