View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_232 (Length: 243)
Name: NF9917A_low_232
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_232 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 137 - 219
Target Start/End: Original strand, 10780032 - 10780114
Alignment:
| Q |
137 |
gtgagaatgttttaatagattggaggcctcctatggagggttgggttaagttgaatagagatgactcttataatgataatggg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
10780032 |
gtgagaatgttttaatagattggaggcctcctatggagggttggattaagttgaatacaaatgactcttaaaatgataatggg |
10780114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University