View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_252 (Length: 239)
Name: NF9917A_low_252
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_252 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 18081104 - 18081144
Alignment:
| Q |
46 |
gtgttgatgtaacaaactcatcgtttcttgtaagaaaatgt |
86 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18081104 |
gtgttgatataacaaactcatcgtttcttgtaagaaaatgt |
18081144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 135
Target Start/End: Original strand, 18095363 - 18095406
Alignment:
| Q |
92 |
aattgttttacactgacagtgtgatcatttactcactcacttca |
135 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||||||||| |
|
|
| T |
18095363 |
aattgttttgcactgacagtgtgtttatttactcactcacttca |
18095406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University