View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_271 (Length: 234)
Name: NF9917A_low_271
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_271 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 2469266 - 2469045
Alignment:
| Q |
7 |
aatgcatcacattgagtaaatttcagaatgtatgagaagaaaaccattgaagtctaagtctagtgatattgttggctagcttgctctgtgaagactttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2469266 |
aatgcatcacattgagtaaatttcagaatgtatgagaagaaaaccattgaagtcta------gtgatattgttggctagcttgctctgtgaagactttta |
2469173 |
T |
|
| Q |
107 |
attatccaatttcattattctaagttgtgaaaatatttcaaccacaattgcttgtattgcatcaacttatcaaccgtggtgattaatcatgaaaaacacc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2469172 |
attatccaatttcattattctaagttgtgaaaatatttcaaccacaattgcttgtattgcatcaacttatcaaccgtggtgattaatcatgaaaaacatc |
2469073 |
T |
|
| Q |
207 |
ttcaaaacaaagaacataacacaaggga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2469072 |
ttcaaaacaaagaacataacacaaggga |
2469045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University