View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_282 (Length: 230)
Name: NF9917A_low_282
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_282 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 9603915 - 9604119
Alignment:
| Q |
1 |
agttctaaccatccaacatatctccgaagtatccaaagtttcactagcattctcatactctatcaaaaccttcatatttaccggcatagacgggtctccg |
100 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9603915 |
agttctaaccatccgacatatctccaaagtatccaaagtttcactagcattctcacactctatcaaaaccttcatatttaccggcatagacgggtctccg |
9604014 |
T |
|
| Q |
101 |
tctacaaataaggtcatatatggtgacttgtgaccctggctaggaatgaactagaatgcacatggtttgtcatcaatatagttgaatgctccgtagatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
9604015 |
tctacaaataaggtcatatatggtgacttgtgatccttgctaggaatgaactagaatacacatggtttgtcctcaatatagttgaatgctccatagatca |
9604114 |
T |
|
| Q |
201 |
agctt |
205 |
Q |
| |
|
||||| |
|
|
| T |
9604115 |
agctt |
9604119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University