View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_319 (Length: 228)
Name: NF9917A_low_319
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_319 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 33631147 - 33630962
Alignment:
| Q |
20 |
taaaaatgagcacaatgtacactaatgaagagaattaatcttaagagtatactctccggtactcaatgcaaacattatacttcttctgtctaatatccat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33631147 |
taaaaatgagcacaatgtacactaatgaagagaattactcttaagagtatactctccagtactcaatgcaaacattatacttcttctgtctaatatccat |
33631048 |
T |
|
| Q |
120 |
ttgtaaatataaatgcnnnnnnnnnnnnnnnnnntgttgttttccattttgaaggttatatttttcataagtgtactgctagattaatattgt |
212 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33631047 |
ttgtaaatataaatgc-------aaaaaaaaaaatgtggttttccatattgaaggttatatttttcataagtgtactgctagattaatattgt |
33630962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University