View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_328 (Length: 226)
Name: NF9917A_low_328
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_328 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 23 - 132
Target Start/End: Complemental strand, 7367097 - 7366990
Alignment:
| Q |
23 |
gatatgaagcataaaaaatgtctttgtgatgtatgcaataagtgaaaagaaatggtcgagggcgtgtgcatgtgatttaggatttttaaaacgtaaagtg |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7367097 |
gatatgaagcataaaaaatgtctt-gtgatgtatgcaataagtgataagaaatggtcgagggcgtgtgcatgtgatttaggattttt-aaacgtaaagtg |
7367000 |
T |
|
| Q |
123 |
attctataaa |
132 |
Q |
| |
|
|||||||||| |
|
|
| T |
7366999 |
attctataaa |
7366990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 132 - 205
Target Start/End: Complemental strand, 7366917 - 7366844
Alignment:
| Q |
132 |
acaacttcaaatatattaatgtttaatttcagcttatttttaaccaaaactcatctcacaatcaattttgaaat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7366917 |
acaacttcaaatatattaatgtttaatttcagcttatttttaaccaaaactcatctcacaatcaattttgaaat |
7366844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University