View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_341 (Length: 222)
Name: NF9917A_low_341
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_341 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 43163797 - 43164013
Alignment:
| Q |
5 |
catcacgtagatgcatgaactattaacaattgttagatcttgcgtttgtaggaaaacatgggtggattaaaataagaaggatcac--tacagtgagatac |
102 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
43163797 |
catcacttagatgcatgaactattaacaattgttagatcttgcgtttgtaggaaaacatgggtggattaaaataagaaggatcactatatagtgagatac |
43163896 |
T |
|
| Q |
103 |
ttcccaatgnnnnnnnnnnnnnnnngagggattcccaatgtttagatcacgagacactttaaatgnnnnnnnnnnnccaaaaacaaaacatgtttggttt |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| | |
|
|
| T |
43163897 |
ttcccaatg---tttttttatttttgagggattcccaatgtttagatcacgagacactttaaatgtttttttgtttccaaacacaaaacatgtttggtct |
43163993 |
T |
|
| Q |
203 |
agtttgtttgttttaatttg |
222 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
43163994 |
agttagtttgttttaatttg |
43164013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 31 - 81
Target Start/End: Original strand, 51466720 - 51466770
Alignment:
| Q |
31 |
caattgttagatcttgcgtttgtaggaaaacatgggtggattaaaataaga |
81 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||||| ||||||||| |
|
|
| T |
51466720 |
caatagttagatcttgcatttggaggaaaacatgggtggataaaaataaga |
51466770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 134 - 167
Target Start/End: Original strand, 51466995 - 51467028
Alignment:
| Q |
134 |
ttcccaatgtttagatcacgagacactttaaatg |
167 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
51466995 |
ttccctatgtttagatcacgagacactttaaatg |
51467028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University