View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_348 (Length: 219)
Name: NF9917A_low_348
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_348 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 198
Target Start/End: Complemental strand, 54978332 - 54978146
Alignment:
| Q |
15 |
aagaatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatgcttgtcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54978332 |
aagaatatcaaaaccgcattcatcacgcatcaattcagagtcacaaccccaaatagcacatctagaactttttgccccggccatatgtggatggttgtcc |
54978233 |
T |
|
| Q |
115 |
aaaccgttactcaactttctacgcttatggtt---gtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54978232 |
aaaccgttactcaactttctacgcttatggttgcagtcgaatctttctggcgaatccattggttggttatcaggagttggtggtgtc |
54978146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University