View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_355 (Length: 216)
Name: NF9917A_low_355
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_355 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 21 - 198
Target Start/End: Original strand, 31997911 - 31998088
Alignment:
| Q |
21 |
atgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttcatggtaa |
120 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
31997911 |
atgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatttcttggtca |
31998010 |
T |
 |
| Q |
121 |
cagttggtttgtttatctttctggctctgcataagaattggattttaannnnnnnaatcaaagtcttttgacctattt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31998011 |
cagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctattt |
31998088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 24 - 106
Target Start/End: Original strand, 15843038 - 15843120
Alignment:
| Q |
24 |
cctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgct |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||| ||||| |
|
|
| T |
15843038 |
cctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University