View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_36 (Length: 393)
Name: NF9917A_low_36
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_36 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 70 - 393
Target Start/End: Original strand, 47116804 - 47117124
Alignment:
| Q |
70 |
ttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataacc |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116804 |
ttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaataacc |
47116903 |
T |
|
| Q |
170 |
aatttcttttacatctttagtttcaattcaaggagataagtattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatg |
269 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116904 |
aatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatg |
47117003 |
T |
|
| Q |
270 |
actcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaac-ggaacgcca |
368 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47117004 |
ac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgcca |
47117099 |
T |
|
| Q |
369 |
acatcaccatcttcgccggtgatga |
393 |
Q |
| |
|
|||||||| ||||| |||||||||| |
|
|
| T |
47117100 |
acatcaccgtcttcaccggtgatga |
47117124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University