View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_366 (Length: 211)
Name: NF9917A_low_366
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_366 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 2582449 - 2582660
Alignment:
| Q |
1 |
aatctcaaaagagattatgggagtgtcatagagaaggttccatgagttaatgaatttatagcctaattttccaacgcattcgaggaacttgatgcagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2582449 |
aatctcaaaagagattatgggagtgtcatagagaaggttccatgagttaatgaatttatagcctaattttccaacgcattcgaggaacttgatgcagcaa |
2582548 |
T |
|
| Q |
101 |
agtgagtgttgtag-aannnnnnnnnnacgaaactaaattaacctatttaaattgacaccatacaaaattaaatctgaaacctcgaggaagaatatactc |
199 |
Q |
| |
|
||||||| |||||| || |||||||||||||| | ||||||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
2582549 |
agtgagtattgtagaaattttctttttacgaaactaaattagcttatttaaattgacaccatacaaaatcaaatctgaaatctcgaggaagaacatactc |
2582648 |
T |
|
| Q |
200 |
caaaatcctaag |
211 |
Q |
| |
|
||| |||||||| |
|
|
| T |
2582649 |
caagatcctaag |
2582660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University