View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_372 (Length: 209)
Name: NF9917A_low_372
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_372 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 31114841 - 31115024
Alignment:
| Q |
14 |
acttctttttctcaaaaccctacggttgtgtgatatttatttcgaagttgaggaagatttcacgaaacttctctctaggtgtcctgaattggagtattga |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114841 |
acttccttttctcaaaaccctacggttgtgtgatatttatttcgaagttgaggaagatttcacgaaacttctctctaggtgtcctgaattggagtattga |
31114940 |
T |
 |
| Q |
114 |
aaacctacaattaattgagtccatatatagagtggtagggttatgtaaacccttatccacgttgatcaaggccgaaatcatttt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114941 |
aaacctacaattaattgagtccatatatagagtggtagggttatgtaaacccttatccacgttgatcaaggccgaaatcatttt |
31115024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 24 - 125
Target Start/End: Original strand, 31088822 - 31088923
Alignment:
| Q |
24 |
ctcaaaaccctacggttgtgtgatatttatttcgaagttgaggaagatttcacgaaacttctctctaggtgtcctgaattggagtattgaaaacctacaa |
123 |
Q |
| |
|
|||||||| |||| |||| | |||||||||||||||||| | | ||||||| ||||||| ||||| ||||||| ||||||||| |||| ||| |||||| |
|
|
| T |
31088822 |
ctcaaaactctacaattgtttaatatttatttcgaagttgggaaggatttcatgaaacttatctctgggtgtcccgaattggaggattggaaaactacaa |
31088921 |
T |
 |
| Q |
124 |
tt |
125 |
Q |
| |
|
|| |
|
|
| T |
31088922 |
tt |
31088923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University