View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_385 (Length: 203)
Name: NF9917A_low_385
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_385 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 42 - 183
Target Start/End: Complemental strand, 38815481 - 38815339
Alignment:
| Q |
42 |
cagcctagagatctaaatagccgtgaagggcctatt-gtgtggtgttgtgttagttgtgatttagtttagtggggcctgagaattttatttgcttttgtc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815481 |
cagcctagagatctaaatagccgtgaagggcctctttgtgtggtgttgtgttagttttgatttagtttagtggggcctgagaattttatttgcttttgtc |
38815382 |
T |
 |
| Q |
141 |
taataggaagtggattgttctgtggcttcctgtggattgtttg |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815381 |
taataggaagtggattgttctgtggcttcctgtggattgtttg |
38815339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University