View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_387 (Length: 202)
Name: NF9917A_low_387
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_387 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 34 - 164
Target Start/End: Original strand, 3098791 - 3098921
Alignment:
| Q |
34 |
attacactcacaactcaatcaccaccattcagtatgtcatacatggcccaccactacattcatcaacggtcacaatccctcttcatgcattgcattcctt |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098791 |
attacactcacaactcaatcaccaccattcagtatgtcatacatggcccaccactacattcatcaacggtcacaatccctcttcatgcattgcattcctt |
3098890 |
T |
|
| Q |
134 |
tcggctacttttgttaccatagagacccaca |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3098891 |
tcggctacttttgttaccatagagacccaca |
3098921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University