View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9917A_low_43 (Length: 380)
Name: NF9917A_low_43
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9917A_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 220 - 374
Target Start/End: Complemental strand, 52763514 - 52763360
Alignment:
| Q |
220 |
taaagaaaacatctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagaggaatactaactaataaaggattt |
319 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52763514 |
taaataaaacatctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagaggaatactacctaataaaggattt |
52763415 |
T |
|
| Q |
320 |
gttcatacaaatgttttgagtccattaccaactacccttttttaatattcttcga |
374 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52763414 |
gttcatacagatgatttgagtccattaccaactacccttttttaattttcttcga |
52763360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 88 - 153
Target Start/End: Complemental strand, 52763646 - 52763581
Alignment:
| Q |
88 |
gcactttgaattgtataacttgctataggatgtagtattcatcctcaatggtcttaaatatcaaca |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||| ||||||||||| |||||||||| |
|
|
| T |
52763646 |
gcactttgaattgtataacttgctataggatctagttgtcatcgtcaatggtcttcaatatcaaca |
52763581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University