View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9917A_low_7 (Length: 464)

Name: NF9917A_low_7
Description: NF9917A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9917A_low_7
NF9917A_low_7
[»] chr5 (1 HSPs)
chr5 (20-464)||(3332102-3332546)
[»] chr8 (1 HSPs)
chr8 (274-354)||(13212814-13212894)
[»] chr1 (3 HSPs)
chr1 (304-352)||(32803230-32803278)
chr1 (304-352)||(16578617-16578665)
chr1 (317-352)||(32809703-32809738)
[»] chr3 (1 HSPs)
chr3 (291-344)||(46200911-46200964)


Alignment Details
Target: chr5 (Bit Score: 417; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 417; E-Value: 0
Query Start/End: Original strand, 20 - 464
Target Start/End: Original strand, 3332102 - 3332546
Alignment:
20 ctaaatatatggtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccggccagcgaaagaatctcgaaccttccatgaagtgtaacaac 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
3332102 ctaaatatatggtcaaaccagaagcagcgggcggagcaggtggtggaagaaacgatccagccagcgaaagaatctcgaaccttccatgaagtgtaacaac 3332201  T
120 agccccaggagaagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcaaagttgttg 219  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
3332202 agctccaggagaagccggttgccttagtgtcacgtttgtaaccgtccctgtcccactcatgatgcaaacgcctctttgacggcgtctagcgaagttgttg 3332301  T
220 acactttcaacaacgtcacaaccgtcggcgacttccatcacgtgagctttcgaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgt 319  Q
    |||||||||||||||||||||||||| || |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
3332302 acactttcaacaacgtcacaaccgtctgcaacttccatcacgtgagttttcaaggcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgt 3332401  T
320 ttttggatccagctggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgt 419  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3332402 ttttggatccagctggtcttcctcttggtcttcttgtcattgaatcggtgtcgccaccggaaccacctcctccggattctaacttggggctaaaatctgt 3332501  T
420 gctgaacttgttgttgctgttttcttctcggtttgtgaggttgag 464  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
3332502 gctgaacttgttgttgctgttttcttctcggtttgtgaggttgag 3332546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 274 - 354
Target Start/End: Original strand, 13212814 - 13212894
Alignment:
274 gcgtttgcgctgtcacgtgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctcttggtcttctt 354  Q
    ||||| |||||||| |  |||||||| || |||||||||||||||||||| || || ||||||||||||||||||||||||    
13212814 gcgttcgcgctgtccctcgtgatgatgataggtggttttggtttgtttttcgaacctgctggtcttcctcttggtcttctt 13212894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 304 - 352
Target Start/End: Original strand, 32803230 - 32803278
Alignment:
304 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 352  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||||||    
32803230 ggtggttttggtctgtttttggatccaggtggtcttcctcttggtcttc 32803278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 304 - 352
Target Start/End: Complemental strand, 16578665 - 16578617
Alignment:
304 ggtggttttggtttgtttttggatccagctggtcttcctcttggtcttc 352  Q
    |||||||||||||||||||| || || | ||||||||||||||||||||    
16578665 ggtggttttggtttgttttttgaaccgggtggtcttcctcttggtcttc 16578617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 317 - 352
Target Start/End: Original strand, 32809703 - 32809738
Alignment:
317 tgtttttggatccagctggtcttcctcttggtcttc 352  Q
    ||||||||||||||| ||||||||||||||||||||    
32809703 tgtttttggatccaggtggtcttcctcttggtcttc 32809738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 344
Target Start/End: Complemental strand, 46200964 - 46200911
Alignment:
291 tgtgatgataatcggtggttttggtttgtttttggatccagctggtcttcctct 344  Q
    |||||||||||| |||||||||||||||||||| || |||| ||| | ||||||    
46200964 tgtgatgataataggtggttttggtttgttttttgagccaggtggacgtcctct 46200911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University